View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_17 (Length: 397)
Name: NF0950_low_17
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_17 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 136; Significance: 8e-71; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 136; E-Value: 8e-71
Query Start/End: Original strand, 130 - 298
Target Start/End: Original strand, 24094387 - 24094555
Alignment:
| Q |
130 |
catcaaaaccccaactgctatgacccagatgcaatctttcccaaacgatgaaggaatttcaaacccatcaccttcgtttgtcaaccacaaatgaaaattt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
24094387 |
catcaaaaccccaactgctatgacccagatgcaatctttcccaaacgatgaaggaatttcaaacccgtcaccgtcgtttgtcacccacaaatgaaaattt |
24094486 |
T |
|
| Q |
230 |
ccattgcgagtgatttcaacgcaaggtaaatcagannnnnnncaaatcaaatctgctaaaatcagtctt |
298 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
24094487 |
ccattgcgagtgatttcaacgcaaggtaaatcagatttttttcaaatcaaatctgctaaaatcagtctt |
24094555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 82; Significance: 1e-38; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 82; E-Value: 1e-38
Query Start/End: Original strand, 292 - 373
Target Start/End: Original strand, 35916494 - 35916575
Alignment:
| Q |
292 |
cagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg |
373 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916494 |
cagtcttctggaagtggaagttgagctgtttcccacaaagggattgatgttgtttcgaaagatgcacatacaaagaaagagg |
35916575 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University