View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_22 (Length: 354)
Name: NF0950_low_22
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_22 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 63; Significance: 2e-27; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 216 - 286
Target Start/End: Original strand, 11847983 - 11848053
Alignment:
| Q |
216 |
tgagtttcggagtttcctatgttcttcaccttgttttactgttttttatgatgtttgttgctgcatggtct |
286 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
11847983 |
tgagttttggagtttcctatgttcttcaccttgttttactgttttttatgatgtttattgctgcatggtct |
11848053 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 130 - 173
Target Start/End: Original strand, 11847901 - 11847944
Alignment:
| Q |
130 |
cttcttattaaacccttccctcaaaactcattttcatcaacaac |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
11847901 |
cttcttattaaacccttccctcaaaactcatttccatcaacaac |
11847944 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 286
Target Start/End: Complemental strand, 11859164 - 11859097
Alignment:
| Q |
219 |
gtttcggagtttcctatgttcttcaccttgttttactgttttttatgatgtttgttgctgcatggtct |
286 |
Q |
| |
|
||||| |||||||||| ||||||||||||||| | |||||| ||||||||||||| ||||||||||| |
|
|
| T |
11859164 |
gtttcagagtttcctacgttcttcaccttgttgtgttgttttctatgatgtttgtttctgcatggtct |
11859097 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University