View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_28 (Length: 314)
Name: NF0950_low_28
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 105 - 236
Target Start/End: Original strand, 23914889 - 23915020
Alignment:
| Q |
105 |
aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggccaatggtagtttagataagtttcttcata |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23914889 |
aagaatttggttcaacttttaggttggtgtgttgagaaaggtgaattgttacttgtgtatgagtttatggttaatggtagtttagataagtttcttcata |
23914988 |
T |
 |
| Q |
205 |
gagaattatctcatgagtgtgatatattgttg |
236 |
Q |
| |
|
||||||||||||||||||||||||| |||||| |
|
|
| T |
23914989 |
gagaattatctcatgagtgtgatattttgttg |
23915020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University