View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_30 (Length: 306)
Name: NF0950_low_30
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_30 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 101 - 226
Target Start/End: Original strand, 8417854 - 8417979
Alignment:
| Q |
101 |
agttgtggacttgtgtctctcacattatagtcctcttcatgatgactattaggatggccttgttgaacttgagggttaattgcgtgcattgtcattggat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8417854 |
agttgtggacttgtgtctctcacattatagtcctcttcatgatgactatttggatggccttgttgaacttgagggttaattgcgtgcattgtcattggat |
8417953 |
T |
|
| Q |
201 |
tattacctcttggtcttctctttatt |
226 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
8417954 |
tattacctcttggtcttctctttatt |
8417979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University