View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_32 (Length: 302)
Name: NF0950_low_32
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_32 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 186; Significance: 1e-101; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 186; E-Value: 1e-101
Query Start/End: Original strand, 65 - 250
Target Start/End: Original strand, 46806182 - 46806367
Alignment:
| Q |
65 |
agaagacacacacagatatacaagcagccgtggaatcagccagaaaggaacttgaggaggtaaaacttaacatagagaaagcaaatgctgaggttagttg |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46806182 |
agaagacacacacagatatacaagcagccgtggaatcagccagaaaggaacttgaggaggtaaaacttaacatagagaaagcaaatgctgaggttagttg |
46806281 |
T |
|
| Q |
165 |
cttgaagctagctgctacatctttaaaatcagaactggaacaagaaaaatcatctcttgcctcgattaggcaaagagagggaatgg |
250 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46806282 |
cttgaagctagctgctacatctttaaaatcagaactggaacaagaaaaatcatctcttgcctcgattaggcaaagagagggaatgg |
46806367 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 108 - 250
Target Start/End: Complemental strand, 5888663 - 5888521
Alignment:
| Q |
108 |
aaaggaacttgaggaggtaaaacttaacatagagaaagcaaatgctgaggttagttgcttgaagctagctgctacatctttaaaatcagaactggaacaa |
207 |
Q |
| |
|
|||||||||||| || ||||| ||| ||||||||||||| | | ||||||| | | ||| ||| | ||||| ||||| |||| ||||||||| |||||| |
|
|
| T |
5888663 |
aaaggaacttgaagaagtaaagcttgacatagagaaagctacttctgaggtaaataacttaaaggtggctgcaacatcattaagatcagaactcgaacaa |
5888564 |
T |
|
| Q |
208 |
gaaaaatcatctcttgcctcgattaggcaaagagagggaatgg |
250 |
Q |
| |
|
|| |||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
5888563 |
gagaaatcatcgcttgcctcgattgggcaaagagagggaatgg |
5888521 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University