View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_33 (Length: 299)
Name: NF0950_low_33
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_33 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 57 - 299
Target Start/End: Complemental strand, 43373170 - 43372928
Alignment:
| Q |
57 |
agataatactcataactactctctagattctgactcactcgatgatttaggagattcagaccgggggaatgaggattcaagtgttgggaattcattccgt |
156 |
Q |
| |
|
|||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43373170 |
agataatactcataactactctctcgattttgactcactcgatgatttaggagattcagaccgggggaatgaggattcaagtgttgggaattcattccgt |
43373071 |
T |
|
| Q |
157 |
tatggaacattggcctctgcaaatgctggaggatcatgttcttattattccaacacgagaatgaattgtgatgagaaagacatttgggtttaccacagct |
256 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43373070 |
tatggaacattggcctccgcaaatgctggaggatcatgttcttattattcaaacacgagaatgaattgtgatgagaaagacatttgggtttaccacagct |
43372971 |
T |
|
| Q |
257 |
attgcatgcctgatgccgggcgttcgcatatggatgaatctac |
299 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
43372970 |
attgcatgcctgatgctgggcgttcgcatatggatgaatctac |
43372928 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University