View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_37 (Length: 286)
Name: NF0950_low_37
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0950_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 74 - 226
Target Start/End: Complemental strand, 7709149 - 7708997
Alignment:
Q |
74 |
tattttgggaaaaaaggaatgaaggagtgttacatagtggttaaccaaatcctcatatattatcatatctttaatatcttttttctttcttaggtgctca |
173 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7709149 |
tattttgggaaaaaaggaatgaaggagtgttacatagtggttaaccaaatcctcatatattatcatatctttaatatcttttttctttcttaggtgctca |
7709050 |
T |
 |
Q |
174 |
ttttgggtttaaagcaaagcaagtgtgatgtttatggtgacttgttgtgatga |
226 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7709049 |
ttttgggtttaaagcaaagcaagtgtgatgtttatggtgacttgttgtgatga |
7708997 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 143 - 224
Target Start/End: Complemental strand, 7711246 - 7711165
Alignment:
Q |
143 |
tttaatatcttttttctttcttaggtgctcattttgggtttaaagcaaagcaagt-gtgatgtttatggtgacttgttgtgat |
224 |
Q |
|
|
|||||| ||||||||||||||||||||||||| ||||| ||||| |||||||||| ||| |||||||||||||||||||||| |
|
|
T |
7711246 |
tttaatctcttttttctttcttaggtgctcatcttgggcttaaaacaaagcaagtactga-gtttatggtgacttgttgtgat |
7711165 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University