View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_41 (Length: 265)
Name: NF0950_low_41
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0950_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 131; Significance: 5e-68; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 23 - 223
Target Start/End: Complemental strand, 32215004 - 32214808
Alignment:
Q |
23 |
cacagacatgtccatacagatttcccttgttatgcaattcatggtttggatcatgcaacatccgcacgcgcgaggcatgtgcactcgaggtgttttccct |
122 |
Q |
|
|
|||| ||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
32215004 |
cacacacatgtccatacagatttcccttgttatgcaattcatggtttgcatcatgcaacatccacacgcgcgaggcatgtgcactcgaggtgttttccct |
32214905 |
T |
 |
Q |
123 |
tgatttctacactcttcatggnnnnnnnnnnnnnnnacctttgacatgtgaatggtacttgggacaaaatttctccaagttgtcttttgattggatcaat |
222 |
Q |
|
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
T |
32214904 |
tgatttctacactcttcattg----ggtttttttttacctttgacatgtgaatggtacttgggacaaaatttctccaagttgtcttttgattgggtcaat |
32214809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University