View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_42 (Length: 264)
Name: NF0950_low_42
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_42 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 137; Significance: 1e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 1 - 197
Target Start/End: Complemental strand, 33102722 - 33102526
Alignment:
| Q |
1 |
tcttcaaatttttattctttagttagtactctaatttttcttgggaatttgttgaagtttgaaactttaagttcctctaatggtggaaccccaatctttt |
100 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||||||||| |||||||||||| | |||||| ||||||| | || | ||||||||||||||||||||||| |
|
|
| T |
33102722 |
tcttcaaattcttattctttaggtagtactctaattttgcttgggaatttgataaagtttaaaactttgaattattgtaatggtggaaccccaatctttt |
33102623 |
T |
 |
| Q |
101 |
ggaattttgatctttaggatttttcataaatgctaattttgttaaggaacctcaccgttgatttaatttggttgttagtgtgatgtcttgttgtgtt |
197 |
Q |
| |
|
||||||||||||||||||||||||| ||||||| ||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33102622 |
ggaattttgatctttaggatttttcttaaatgcaaattttgttgaggaacctcaccgttcatttaatttggttgttagtgtgatgtcttgttgtgtt |
33102526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University