View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_45 (Length: 255)
Name: NF0950_low_45
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_45 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 21 - 221
Target Start/End: Complemental strand, 51532169 - 51531970
Alignment:
| Q |
21 |
tgatgacacttccatttatctgtgtgtgtttttctgtcagagaaactaaatttttgaccgacgaatatctttcttatcaaatagagttaaatgttacaat |
120 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51532169 |
tgatgatacttccatttatctgtgtctgtttttctgtcacagaaactaaatttttgaccgacgaatatctttcttatcaaatagagttaaatgttacaat |
51532070 |
T |
|
| Q |
121 |
cttgatcgaaaaaagagttaatgttacaattagttgagttttcatccttgttaatatattatcgtttgtcacgaagaacatcacaaatcacatgaatgat |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
51532069 |
cttgat-aaaaaaagagttaatgttacaattagttgagttttcatccttgttaatatattatcgtttatcacgaagaacatcacaaatcacatgaatgat |
51531971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University