View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_52 (Length: 221)
Name: NF0950_low_52
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_52 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 117; Significance: 9e-60; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 148
Target Start/End: Complemental strand, 27186014 - 27185856
Alignment:
| Q |
1 |
taatcctaaaaagagaagtatacaaggtaattaagatgacagtttaacttccaaataataatagaa-----------gtaattaatagaacatcaccaaa |
89 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
27186014 |
taatcctaaaaagagaagtatacaaggtaattaagatgacagtttaacttccaaataataatagaatgataatggaagtaattaatagaacatcaccaaa |
27185915 |
T |
|
| Q |
90 |
taattccatctataagtcttaatctattaaacatgtgttaattgtgatttgcagaataa |
148 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27185914 |
taattccatctataagtcttaatctattaaacatgtgttaattgtgatttgcagtataa |
27185856 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 78 - 148
Target Start/End: Original strand, 27229433 - 27229503
Alignment:
| Q |
78 |
aacatcaccaaataattccatctataagtcttaatctattaaacatgtgttaattgtgatttgcagaataa |
148 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
| T |
27229433 |
aacatcaccaaataattccatgtatcagtcttaatctattgaacatgtgttaattgtgatttgcaggataa |
27229503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University