View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_54 (Length: 217)
Name: NF0950_low_54
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_54 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 2 - 113
Target Start/End: Original strand, 21376931 - 21377042
Alignment:
| Q |
2 |
caaaccaacaccttcactcttcgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac |
101 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21376931 |
caaaccaacaccttcactctttgatttggatttggaagttttgtcttcccgaaaaatataaatttcttttttggctgacttgtaacaatccggttcctac |
21377030 |
T |
 |
| Q |
102 |
ctcatctctgct |
113 |
Q |
| |
|
|| |||| |||| |
|
|
| T |
21377031 |
cttatctttgct |
21377042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University