View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0950_low_56 (Length: 213)
Name: NF0950_low_56
Description: NF0950
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0950_low_56 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 115; Significance: 1e-58; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 1 - 119
Target Start/End: Original strand, 12368282 - 12368400
Alignment:
| Q |
1 |
gaaatcaattgcgttactgacttaaaatatgtgatatgcagcagaagcctaagatgtctgtgccacaatttggagggtgggaaaataagtcaaaaggagt |
100 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12368282 |
gaaatcaattgagttactgacttaaaatatgtgatatgcagcagaagcctaagatgtctgtgccacaatttggagggtgggaaaataagtcaaaaggagt |
12368381 |
T |
|
| Q |
101 |
gcctactgactactcgatg |
119 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
12368382 |
gcctactgactactcgatg |
12368400 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University