View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_high_23 (Length: 228)
Name: NF0951_high_23
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_high_23 |
 |  |
|
| [»] chr8 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 228
Target Start/End: Original strand, 29142729 - 29142831
Alignment:
| Q |
125 |
ggtgatgtatgtaatttgtttatatatagcaaagtatatggggtgatagataggataacaatgacttcacattattattatgatgatagtgttgaacctg |
224 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29142729 |
ggtgatgtatgtaatttgtttatatgtagcaa-gtatatggggtgatagataggataacaatgacttcacattattattatgatgatagtgttgaacctg |
29142827 |
T |
 |
| Q |
225 |
ccaa |
228 |
Q |
| |
|
|||| |
|
|
| T |
29142828 |
ccaa |
29142831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 29142612 - 29142697
Alignment:
| Q |
8 |
taactagaataaaaaatctactaataaagaatatatttttaactgaactacaattaccatatgtccatgctaaaaacttgtttaga |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29142612 |
taactagaataaaaaatctactaataaagaatatacttttaactgaactacaattaacatatgtccatgctaaaaacttgtttaga |
29142697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University