View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_high_7 (Length: 341)
Name: NF0951_high_7
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 96 - 246
Target Start/End: Complemental strand, 53147775 - 53147626
Alignment:
| Q |
96 |
aagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaaatcagtgatacgtcaacattcctgactttc |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
53147775 |
aagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaa-tcagtgatacgtcaacattcctgactttc |
53147677 |
T |
 |
| Q |
196 |
tggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53147676 |
tggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg |
53147626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University