View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_12 (Length: 393)
Name: NF0951_low_12
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 296; Significance: 1e-166; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 296; E-Value: 1e-166
Query Start/End: Original strand, 1 - 316
Target Start/End: Complemental strand, 33293450 - 33293135
Alignment:
| Q |
1 |
ttcatttgcatccgcatgttggtagttcgatgattagcttgttggtgaaatgtgggaatcttaacgatgcgcggatggtctttgatgggatgcctgaaag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33293450 |
ttcatttgcatccgcatgttggtagttcgatgattaactttttggtgaaatgtgggaatcttaacgatgcgcggatggtctttgatgggatgcctgaaag |
33293351 |
T |
|
| Q |
101 |
ggatgttgtatgttggaattcgataattggaggctatgtgcaggaggaccttttgaaagaggtaattcagttgtttgttgagatgattagttgtgggata |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33293350 |
ggatgttgtatgttggaattcgataattggaggctatgtgcaggagggccttttgaaagaggtaattcagttgtttgttgagatgattagttgtgggata |
33293251 |
T |
|
| Q |
201 |
aggccgagttctgtgactatggctagcgtacttaaagcgtgtggcgaaagtggacacaagaaactgggaatgtgtgttcatgtttttgtgcttgcattag |
300 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
33293250 |
aggccgagttctgtgactatggctagcatacttaaagcgtgtggcgaaagtggacacaagaaactgggaacgtgtgttcatgtttttgtgcttgcattag |
33293151 |
T |
|
| Q |
301 |
gcatgggtgatgatgt |
316 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
33293150 |
gcatgggtgatgatgt |
33293135 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University