View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0951_low_19 (Length: 341)

Name: NF0951_low_19
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0951_low_19
NF0951_low_19
[»] chr3 (1 HSPs)
chr3 (96-246)||(53147626-53147775)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 4e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 4e-75
Query Start/End: Original strand, 96 - 246
Target Start/End: Complemental strand, 53147775 - 53147626
Alignment:
96 aagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaaatcagtgatacgtcaacattcctgactttc 195  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
53147775 aagcttccgtgacttttttgtgtaatgataaaatattttagggattgatatgatacggaaataaataaaa-tcagtgatacgtcaacattcctgactttc 53147677  T
196 tggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg 246  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
53147676 tggatccctcatactttttgctatctgtagatcttgggaaacatgatgatg 53147626  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University