View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_24 (Length: 332)
Name: NF0951_low_24
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_24 |
 |  |
|
| [»] chr4 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 2e-46; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 2e-46
Query Start/End: Original strand, 234 - 332
Target Start/End: Original strand, 14259578 - 14259676
Alignment:
| Q |
234 |
ctggataagtttgtatcgatttgaagatataatcgggatgctggctaaagttgaggttgaagatgaatatatttttgatggtgttatgacgaagattat |
332 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14259578 |
ctggataaatttgtatcgatttgaagatataatcgggatgctggctaaagttgaggttgaagatgaatatatttttgatggtgttatgacgaagattat |
14259676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 84; E-Value: 7e-40
Query Start/End: Original strand, 96 - 179
Target Start/End: Original strand, 14259440 - 14259523
Alignment:
| Q |
96 |
tattattcctattttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggttggggagttacgatta |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14259440 |
tattattcctattttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggttggggagttacgatta |
14259523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Complemental strand, 6604689 - 6604629
Alignment:
| Q |
102 |
tcctattttttgacccatccttcagtttttctttcaaatatttacaaatctgaagttatggt |
163 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||| |||||| | |||||||||||| |
|
|
| T |
6604689 |
tcctatttttt-acccatccttcggtttttctttcaaatagttacaattatgaagttatggt |
6604629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University