View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_26 (Length: 320)
Name: NF0951_low_26
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_26 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 30 - 269
Target Start/End: Complemental strand, 37425460 - 37425224
Alignment:
| Q |
30 |
tttatgagcagaaaaggctgataaaaagtgaatgttttaacaccaaaggtttttactggtttgattatttaagcaatgcttccctaccaattttcagcat |
129 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425460 |
tttatgagcagaaaaggctgataaacagtgaatgttttaacaccaaaggtttttactggtttgattatttaagcaatgcttccctaccaattttcagcat |
37425361 |
T |
 |
| Q |
130 |
gacgatgaagagtgtcggagtgcagctctcaaaaatggttgtagaagttcattcaaaattcaattctattcgcagtcttatnnnnnnnnnnngagcaaaa |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
37425360 |
gacgatgaagagtgtcggagtgcagctctcaaaaatggttgtagaagttcattcaaaattcaattctattcgcagtcttat---aaaaaaaagagcaaaa |
37425264 |
T |
 |
| Q |
230 |
ccagattatgctacctgcataaagatttccattgatgcct |
269 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37425263 |
ccagattatgctacctgcataaagatttccattgatgcct |
37425224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 264 - 309
Target Start/End: Complemental strand, 43015005 - 43014960
Alignment:
| Q |
264 |
atgcctatgatggtctatggaaaaagtgtctgcttaatccatctct |
309 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43015005 |
atgcctttgatggtctatggaaaaagtgtctgcttaatccatctct |
43014960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University