View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_28 (Length: 311)
Name: NF0951_low_28
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_28 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 44; Significance: 5e-16; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 81 - 124
Target Start/End: Original strand, 43367217 - 43367260
Alignment:
| Q |
81 |
tgagatgaatatgtgttgtagttagaatttccataatgcgtgtg |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43367217 |
tgagatgaatatgtgttgtagttagaatttccataatgcgtgtg |
43367260 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University