View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_29 (Length: 310)
Name: NF0951_low_29
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 88 - 242
Target Start/End: Complemental strand, 31930550 - 31930396
Alignment:
| Q |
88 |
gttgaattgcatactaggtttatctcttaatacattttgtcaaaatatctaaaattgtgcaaaccgactattaagtaggatgtacttatgataaaacaac |
187 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
31930550 |
gttgaattgcatagtaggtttatctcttaatacattttgtcaagatacctaaaattgtgcaaattgactattaactaggatgtacctatgataaaacaac |
31930451 |
T |
|
| Q |
188 |
tcagtcaaaattgtatcggacttccaccgcaatgtagaatctacactagaattat |
242 |
Q |
| |
|
|| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31930450 |
tcggtcaaaattgtatcggacttccaccgtaatgtagaatctacactagaattat |
31930396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 177 - 229
Target Start/End: Complemental strand, 6896539 - 6896487
Alignment:
| Q |
177 |
gataaaacaactcagtcaaaattgtatcggacttccaccgcaatgtagaatct |
229 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||| ||| ||||| |||| |
|
|
| T |
6896539 |
gataaaacaactcagctaaaattgtatcggactcccactgcattgtaggatct |
6896487 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University