View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0951_low_31 (Length: 306)

Name: NF0951_low_31
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0951_low_31
NF0951_low_31
[»] chr8 (3 HSPs)
chr8 (54-230)||(27065656-27065832)
chr8 (54-212)||(27079391-27079549)
chr8 (58-213)||(27053231-27053386)


Alignment Details
Target: chr8 (Bit Score: 161; Significance: 7e-86; HSPs: 3)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 161; E-Value: 7e-86
Query Start/End: Original strand, 54 - 230
Target Start/End: Complemental strand, 27065832 - 27065656
Alignment:
54 tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 153  Q
    |||||||||||| ||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||    
27065832 tgagatgaagcaagttttcaaggtgtccgagaattcttcgatgaataagatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 27065733  T
154 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcg 230  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
27065732 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggtcacagtgttactgttcg 27065656  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 71; E-Value: 4e-32
Query Start/End: Original strand, 54 - 212
Target Start/End: Complemental strand, 27079549 - 27079391
Alignment:
54 tgagatgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaa 153  Q
    |||| ||||||| |||||||||||||| |||||||| |||||| | || ||||| |||||  | ||| ||||||| |||||||| |||||| | |||||     
27079549 tgagttgaagcaagtttttaaggtgtctgagaattcctcgatggataagatgatagtggactcattgggtgagtgtgagagggcaccgagtatgggtgag 27079450  T
154 acgaagcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttggg 212  Q
    || ||||||||||| ||||| ||||||||||||||||| ||||||||||| ||||||||    
27079449 acaaagcgttgtgttggttcacttgaggatatgattgactttgcaacttcagttttggg 27079391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 44; E-Value: 5e-16
Query Start/End: Original strand, 58 - 213
Target Start/End: Complemental strand, 27053386 - 27053231
Alignment:
58 atgaagcaggtttttaaggtgtccgagaattcttcgatgaacaaaatgatggtggatgcgttgagtgagtgcgagagggcgccgagtgtaggtgaaacga 157  Q
    |||||||| ||||| |||||||| || ||||| |  ||| | || ||||| |||||  | ||||||||||| || || ||||| |||  |||||| |  |    
27053386 atgaagcaagttttcaaggtgtctgaaaattcctttatggaaaagatgatagtggactcattgagtgagtgtgaaagagcgccaagtaaaggtgagatca 27053287  T
158 agcgttgtgtgggttctcttgaggatatgattgattttgcaacttctgttttgggt 213  Q
    |||||||||| ||||| |||||||| |||||||| |||||||||||| ||||||||    
27053286 agcgttgtgtaggttcgcttgaggacatgattgactttgcaacttctattttgggt 27053231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University