View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_46 (Length: 250)
Name: NF0951_low_46
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0951_low_46 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 29 - 240
Target Start/End: Complemental strand, 35710052 - 35709839
Alignment:
Q |
29 |
gtgaaataatgttccatctgttgttccttt------tcattcaagtgtttttaattatgtattttggcttattgttgtacgctgcgttgtcatttttgtt |
122 |
Q |
|
|
|||||||||||||||||||||||||||||| | | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
35710052 |
gtgaaataatgttccatctgttgttcctttcaagcttaagtcaagtgtttttaattatgtattttggcttattgttgtacgctgcgttgtcatttttgtt |
35709953 |
T |
 |
Q |
123 |
gtcgcaagcttagctgtctaatgatgtgggcaattcgaaccaagaccttattcaatcccaatgctgnnnnnnnnnnngttatatcatggtcaacagttct |
222 |
Q |
|
|
||||||| ||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
T |
35709952 |
gtcgcaaacttagctgtctaatgatatgggcaattcgaaccaagaccttattcaatcccaatgctg---tttttttcgttatatcatggtcaacagttct |
35709856 |
T |
 |
Q |
223 |
atatattattatcctttg |
240 |
Q |
|
|
|||||||| ||||||||| |
|
|
T |
35709855 |
atatatta-tatcctttg |
35709839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University