View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0951_low_51 (Length: 228)

Name: NF0951_low_51
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0951_low_51
NF0951_low_51
[»] chr8 (2 HSPs)
chr8 (125-228)||(29142729-29142831)
chr8 (8-93)||(29142612-29142697)


Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 125 - 228
Target Start/End: Original strand, 29142729 - 29142831
Alignment:
125 ggtgatgtatgtaatttgtttatatatagcaaagtatatggggtgatagataggataacaatgacttcacattattattatgatgatagtgttgaacctg 224  Q
    ||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
29142729 ggtgatgtatgtaatttgtttatatgtagcaa-gtatatggggtgatagataggataacaatgacttcacattattattatgatgatagtgttgaacctg 29142827  T
225 ccaa 228  Q
    ||||    
29142828 ccaa 29142831  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 8 - 93
Target Start/End: Original strand, 29142612 - 29142697
Alignment:
8 taactagaataaaaaatctactaataaagaatatatttttaactgaactacaattaccatatgtccatgctaaaaacttgtttaga 93  Q
    ||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||    
29142612 taactagaataaaaaatctactaataaagaatatacttttaactgaactacaattaacatatgtccatgctaaaaacttgtttaga 29142697  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University