View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_52 (Length: 227)
Name: NF0951_low_52
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0951_low_52 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 9026746 - 9026969
Alignment:
Q |
1 |
caagcactgtataattgtcctttgtatacagttatagcactatactac-gtccaaatctttgactattatgtctttatttcaactgcatgccctaatcta |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9026746 |
caagcactgtataattgtcctttgtatacagttatagcactatactactgtccaaatctttgactattatgtctttatttcaactgcatgccctaatcta |
9026845 |
T |
 |
Q |
100 |
taacacacgacat-nnnnnnnnnnnnnnttatataccatcatgaactaaaaataattcagggcttaaaacaaatataccattggaacttagttttaggtg |
198 |
Q |
|
|
||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
T |
9026846 |
taacacacgacataacaaaacaaaaaaattgtataccatcatgaactaaaaataattcagggcttaaaacaaatctaccattggaacttagttttaggtg |
9026945 |
T |
 |
Q |
199 |
gatatggggttttctgataatgat |
222 |
Q |
|
|
|||||||||||||||||||||||| |
|
|
T |
9026946 |
gatatggggttttctgataatgat |
9026969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University