View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_53 (Length: 223)
Name: NF0951_low_53
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_53 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 200
Target Start/End: Original strand, 43107702 - 43107901
Alignment:
| Q |
1 |
ggaagttctttttgcaaacatcacaacttaattttacatcattagaattgcaattagcctttgctttcgactcaccctctttccctagggcttgactatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107702 |
ggaagttctttttgcaaacatcacaacttaattttacatcattagaattgcaattagcctctgctttcgactcaccctctttccctagggcttgactatg |
43107801 |
T |
|
| Q |
101 |
gattcttttgtgaccacctaatccttttccacacctaaaaattttgttacataattcacacttgtgaatttttgaacttgttgatccttcatcatgatga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107802 |
gattcttttgtgaccacctaatccttttccacacctaaaaattttgttacataattcacacttgtgaatttttgaacttgttgatccttcatcatgatga |
43107901 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University