View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_56 (Length: 206)
Name: NF0951_low_56
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0951_low_56 |
 |  |
|
[»] chr4 (3 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 8e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 8e-60
Query Start/End: Original strand, 90 - 206
Target Start/End: Complemental strand, 23989559 - 23989443
Alignment:
Q |
90 |
atatacatcatgtgacatacccttttaagagatgagaccgggaaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagatactcat |
189 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
23989559 |
atatacatcatgtgacatacccttttaagagatgagaccgggaaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagatactcat |
23989460 |
T |
 |
Q |
190 |
tgtaatcatcattccac |
206 |
Q |
|
|
||||||||||||||||| |
|
|
T |
23989459 |
tgtaatcatcattccac |
23989443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 101 - 166
Target Start/End: Complemental strand, 23965559 - 23965494
Alignment:
Q |
101 |
gtgacatacccttttaagagatgagaccgggaaacaactgtaaacatgttcaaagatctcattgtg |
166 |
Q |
|
|
|||||||||||| || ||||||||||| | |||||||||||||||||||||||||||||||||||| |
|
|
T |
23965559 |
gtgacataccctattcagagatgagacagagaaacaactgtaaacatgttcaaagatctcattgtg |
23965494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 90 - 183
Target Start/End: Complemental strand, 23982877 - 23982784
Alignment:
Q |
90 |
atatacatcatgtgacatacccttttaagagatgagaccgggaaacaactgtaaacatgttcaaagatctcattgtgcagtccgttccatagat |
183 |
Q |
|
|
|||||||||||||||||||||||||||||||| |||| || ||||||||||||| ||||||||| |||||| ||||| |||||||||||| |
|
|
T |
23982877 |
atatacatcatgtgacatacccttttaagagacgagattggtaaacaactgtaaaattgttcaaaggtctcatcaggcagtgcgttccatagat |
23982784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 78; Significance: 2e-36; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 14 - 99
Target Start/End: Complemental strand, 24766462 - 24766377
Alignment:
Q |
14 |
ataatacttatgaaacaaaagttgaaaaacttgcaacatatgaacccaaaaccaattctggaggcttagacaaatcatatacatca |
99 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
T |
24766462 |
ataatacttatgaaacaaaagttgaaaaacttgcaacatatgaacccaaaaccaattctggaggcttagacaaatcttaaacatca |
24766377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University