View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_57 (Length: 203)
Name: NF0951_low_57
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_57 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 6 - 117
Target Start/End: Original strand, 29931962 - 29932073
Alignment:
| Q |
6 |
acttcaagtgtaaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgcagcagttatat |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29931962 |
acttcaagtgtaaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgcagcagttatat |
29932061 |
T |
|
| Q |
106 |
ttcagaataatc |
117 |
Q |
| |
|
|||||| ||||| |
|
|
| T |
29932062 |
ttcagattaatc |
29932073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 11 - 95
Target Start/End: Original strand, 29934691 - 29934775
Alignment:
| Q |
11 |
aagtgtaaaagcatccctcccaccattggcgggacggctgcaattgtttccagcatcattgcatggcatccgtaccgttcctgca |
95 |
Q |
| |
|
||||||||||||||||||||||||||| ||||| ||||| |||||||| ||||||||||||||||| || || |||||||||| |
|
|
| T |
29934691 |
aagtgtaaaagcatccctcccaccattccagggaccgctgctattgtttctagcatcattgcatggcaaccatatcgttcctgca |
29934775 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University