View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0951_low_59 (Length: 201)
Name: NF0951_low_59
Description: NF0951
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0951_low_59 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 52; Significance: 5e-21; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 52; E-Value: 5e-21
Query Start/End: Original strand, 14 - 65
Target Start/End: Complemental strand, 43083437 - 43083386
Alignment:
| Q |
14 |
tatatagtatatatactaagttttattatcaattaacgtgactaatctctat |
65 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43083437 |
tatatagtatatatactaagttttattatcaattaacgtgactaatctctat |
43083386 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University