View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_high_12 (Length: 252)
Name: NF0952_high_12
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_high_12 |
 |  |
|
| [»] scaffold0438 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr3 (Bit Score: 207; Significance: 1e-113; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 7102995 - 7103217
Alignment:
| Q |
1 |
caatttatctttcaaaattaaaaggcagatttcaccttttgaataattaacttgggctgaaggtgagttttgaagcaaaaagtcaattattccctcaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102995 |
caatttatctttcaaaattaaaaggaagatctcaccttttgaataattaacttgggctgaaggtgagttttgaagcaaaaagtcaattattccctcaggt |
7103094 |
T |
 |
| Q |
101 |
atggatgatgatccttttttgaaggcttctcgtaacgtggcaacttctttctgtgacatggcaggatttagagctaatttggcatctatgagtgcgttgg |
200 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
7103095 |
atggatgatgatctttttttgaaggcttctcgtaacgtggcaacttctttctgtgacatggcaggatttagagctaatttggaatctatgagtgcgttgg |
7103194 |
T |
 |
| Q |
201 |
aaaagcaatatgaaagttgtttc |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
7103195 |
aaaagcaatatgaaagttgtttc |
7103217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 59 - 194
Target Start/End: Complemental strand, 7127258 - 7127123
Alignment:
| Q |
59 |
gaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggatgatgatccttttttgaaggcttctcgtaacgtggcaacttctttctgtgaca |
158 |
Q |
| |
|
||||||||||||||||||||||||| || |||||| |||||||||||||| ||||||| ||| || ||||||| |||| ||||| |||||| |||||| |
|
|
| T |
7127258 |
gaaggtgagttttgaagcaaaaagtaaactattccatcaggtatggatgaagatccttctttaaatgcttctcttaacttggcagcttcttcttgtgacc |
7127159 |
T |
 |
| Q |
159 |
tggcaggatttagagctaatttggcatctatgagtg |
194 |
Q |
| |
|
|||||| ||||||||||||||||||| |||| |
|
|
| T |
7127158 |
cggcaggcaactgagctaatttggcatctatcagtg |
7127123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 56 - 108
Target Start/End: Complemental strand, 13493257 - 13493205
Alignment:
| Q |
56 |
gctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggatga |
108 |
Q |
| |
|
|||||||||||||||||||||||||| |||| ||||||||||||||||||||| |
|
|
| T |
13493257 |
gctgaaggtgagttttgaagcaaaaattcaagtattccctcaggtatggatga |
13493205 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 57 - 108
Target Start/End: Original strand, 6561411 - 6561462
Alignment:
| Q |
57 |
ctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggatga |
108 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
6561411 |
ctgaaggtgagttttgaagcataaagtcaagtattccctcaggtatggatga |
6561462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 56 - 105
Target Start/End: Complemental strand, 7120029 - 7119980
Alignment:
| Q |
56 |
gctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatgga |
105 |
Q |
| |
|
||||||||||||||||||||||||||||| | |||||| ||||||||||| |
|
|
| T |
7120029 |
gctgaaggtgagttttgaagcaaaaagtcgactattccatcaggtatgga |
7119980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 58 - 115
Target Start/End: Complemental strand, 13460889 - 13460832
Alignment:
| Q |
58 |
tgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggatgatgatcct |
115 |
Q |
| |
|
||||| |||||||||||||||||| | ||| ||| | |||||||||||||| |||||| |
|
|
| T |
13460889 |
tgaagttgagttttgaagcaaaaaattaatcatttcatcaggtatggatgacgatcct |
13460832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 56 - 108
Target Start/End: Original strand, 27700742 - 27700794
Alignment:
| Q |
56 |
gctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggatga |
108 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||| || |||||||| ||||| |
|
|
| T |
27700742 |
gctgaaggcgagttttgaagcaaaaagtcaactataccatcaggtatagatga |
27700794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 26292052 - 26292024
Alignment:
| Q |
59 |
gaaggtgagttttgaagcaaaaagtcaat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26292052 |
gaaggtgagttttgaagcaaaaagtcaat |
26292024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 26305309 - 26305281
Alignment:
| Q |
59 |
gaaggtgagttttgaagcaaaaagtcaat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26305309 |
gaaggtgagttttgaagcaaaaagtcaat |
26305281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 26338664 - 26338636
Alignment:
| Q |
59 |
gaaggtgagttttgaagcaaaaagtcaat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
26338664 |
gaaggtgagttttgaagcaaaaagtcaat |
26338636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 50 - 105
Target Start/End: Original strand, 33839151 - 33839206
Alignment:
| Q |
50 |
acttgggctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatgga |
105 |
Q |
| |
|
|||| |||||| ||||||||||||||||| ||||| | |||||| ||||||||||| |
|
|
| T |
33839151 |
actttggctgacggtgagttttgaagcaagaagtccactattccatcaggtatgga |
33839206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 56 - 106
Target Start/End: Complemental strand, 7023127 - 7023077
Alignment:
| Q |
56 |
gctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatggat |
106 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||| |||||| |||||||||||| |
|
|
| T |
7023127 |
gctgagggtgactttcgaagcaaaaagtcaactattccatcaggtatggat |
7023077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 62 - 108
Target Start/End: Complemental strand, 28092182 - 28092136
Alignment:
| Q |
62 |
ggtgagttttgaagcaaaaagtcaattattccctcaggtatggatga |
108 |
Q |
| |
|
||||||||||||| ||||||||| | |||||| |||||||||||||| |
|
|
| T |
28092182 |
ggtgagttttgaatcaaaaagtccactattccatcaggtatggatga |
28092136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0438 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: scaffold0438
Description:
Target: scaffold0438; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 59 - 87
Target Start/End: Complemental strand, 6434 - 6406
Alignment:
| Q |
59 |
gaaggtgagttttgaagcaaaaagtcaat |
87 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
6434 |
gaaggtgagttttgaagcaaaaagtcaat |
6406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 56 - 104
Target Start/End: Original strand, 36590357 - 36590405
Alignment:
| Q |
56 |
gctgaaggtgagttttgaagcaaaaagtcaattattccctcaggtatgg |
104 |
Q |
| |
|
||||| ||||||||||||| ||||||||| | |||||| |||||||||| |
|
|
| T |
36590357 |
gctgacggtgagttttgaatcaaaaagtccactattccatcaggtatgg |
36590405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University