View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_low_11 (Length: 371)
Name: NF0952_low_11
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_low_11 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 159 - 358
Target Start/End: Original strand, 7318052 - 7318250
Alignment:
| Q |
159 |
actatcccactctcagcaagtatgatctgaaatttcatcatatcataccagctggtccatttcttcttctcaaagaacaagtactaaatccaacggctga |
258 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7318052 |
actatcccactctcggcaagtatgatgtgaaatttcatcatatcatactagctggtccatttattcttctcaaagaacaagtactaaatccaacggctga |
7318151 |
T |
|
| Q |
259 |
gatctatctcctcccgtgggtcccatcgagagtgcatgagcattttcacgtcgcgagtttataccgtgactcggtgcgtgaataaaactcgttcttcttc |
358 |
Q |
| |
|
|||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7318152 |
gatctatctcct-ccgtgggtcccaccgagagtgcatgagcattttcacgtcgcgagtttacaccgtgaatcggtgcgtgaataaaactcattcttcttc |
7318250 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 156; Significance: 8e-83; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 156; E-Value: 8e-83
Query Start/End: Original strand, 159 - 358
Target Start/End: Complemental strand, 2720456 - 2720263
Alignment:
| Q |
159 |
actatcccactctcagcaagtatgatctgaaatttcatcatatcataccagctggtccatttcttcttctcaaagaacaagtactaaatccaacggctga |
258 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2720456 |
actatcccactctcag----tatgatgtgaaatttcatcatatcataccagctggtccatttcttcttctcaaagaacaagtattaaatccaacggctga |
2720361 |
T |
|
| Q |
259 |
gatctatctcctcccgtgggtcccatcgagagtgcatgagcattttcacgtcgcgagtttataccgtgactcggtgcgtgaataaaactcgttcttcttc |
358 |
Q |
| |
|
||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
2720360 |
gat--atctcctcccgtgggtcccaccgagagtgcatgagcattttcacgtcgcgagtttataccatgactcggtgcgtgaataaaactcgttcttcttc |
2720263 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University