View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_low_17 (Length: 332)
Name: NF0952_low_17
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_low_17 |
 |  |
|
| [»] chr6 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 242; Significance: 1e-134; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 61 - 332
Target Start/End: Complemental strand, 1446440 - 1446170
Alignment:
| Q |
61 |
ccatctactaaaaatttcaaaatcaataatggtgtattataataaagtgaaatttctcaacttgatggcttgcagagtggctatgcaattcctttatact |
160 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1446440 |
ccatctactaaaaatttcaaaatcaataatggtgtattataataaagtgaaatttctcaacttgatggcttgcagagtggctatgcaattcctttatact |
1446341 |
T |
 |
| Q |
161 |
atagtacactgccatatcatatatgtataaaaatatttatctagatccatctagtgcacatggattgcttcttaccnnnnnnnccttctacctataacat |
260 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1446340 |
atagtacattgccatatcatatatgtataaaaatatttatctagatccatctagtgcacatggattgcttcttacc-ttttttccttctacctataacat |
1446242 |
T |
 |
| Q |
261 |
tggtaaaaatgcatgccttttgttcttattatagcaacaaagattgcaattgcattccactcaatgcacaac |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1446241 |
tggtaaaaatgcatgccttttgttcttattatagcaacaaagattgcaattgcattccactcaatgcacaac |
1446170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 104 - 207
Target Start/End: Original strand, 3927475 - 3927580
Alignment:
| Q |
104 |
aaagtgaaatttctcaacttgatggcttgcagagtggct--atgcaattcctttatactatagtacactgccatatcatatatgtataaaaatatttatc |
201 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| | ||| |||||| ||||| ||||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
3927475 |
aaagtgaaatttctcaacttgaaggcttgcagaatagctttatgcaacgcctttctactatagtacacaactgtatcatatatgtataaaaatagttatg |
3927574 |
T |
 |
| Q |
202 |
tagatc |
207 |
Q |
| |
|
|||||| |
|
|
| T |
3927575 |
tagatc |
3927580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University