View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_low_19 (Length: 321)
Name: NF0952_low_19
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 89; Significance: 7e-43; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 89; E-Value: 7e-43
Query Start/End: Original strand, 99 - 206
Target Start/End: Complemental strand, 43597967 - 43597857
Alignment:
| Q |
99 |
attaagttcaatagctgcatttttgtgtaataacctcgcaaaga---tcgataatctaacacacttacatgaatattagtggcatgtgaaactttgtcat |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43597967 |
attaagttcaatagctgcatttttgtgtaagaacctctcaaagaagatcgataatctaacacacttacatgaatattagtggcatgtgaaactttgtcat |
43597868 |
T |
|
| Q |
196 |
gtcattaacaa |
206 |
Q |
| |
|
||||||||||| |
|
|
| T |
43597867 |
gtcattaacaa |
43597857 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 202 - 286
Target Start/End: Complemental strand, 43597835 - 43597747
Alignment:
| Q |
202 |
aacaacacatataaggatgaccttctaaggtatttgctaattcatgattgt----gagtatcacaccgaacatgaactatccattctct |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
43597835 |
aacaacacatataaggatgaccttctaaggtatttgctaattcatgattgtgagtgagtatcacactgaacatgaactatccattctct |
43597747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University