View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_low_24 (Length: 258)
Name: NF0952_low_24
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_low_24 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 97; Significance: 9e-48; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 23 - 175
Target Start/End: Original strand, 38365986 - 38366138
Alignment:
| Q |
23 |
ggcggttgaggcgttgaatccgcatgtgcaacagaaatggttttgttctttttccgaacaaaattattataagnnnnnnnnnnnnnnnnctttgataccg |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
38365986 |
ggcggttgaggcgttgaatccgcatgtgcaacaaaaatggttttgttctttttccaaacaaaattattataagtttttgtttgttttttctttgataccg |
38366085 |
T |
 |
| Q |
123 |
ttaatcaagggaaataattattggcaagctatacatttcttcatcctctcata |
175 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38366086 |
ttaatcaagggaaataattattggcaagctatacatttcttcatcctctcata |
38366138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 175 - 229
Target Start/End: Original strand, 38366167 - 38366221
Alignment:
| Q |
175 |
actgggacgtctcaaggaaaatgtatggggctgaatgaatgaagaaggacgtgac |
229 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38366167 |
actgggacgtctcaaggaaaatgtatggggctgaatgaatgaagaaggacgtgac |
38366221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University