View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0952_low_31 (Length: 251)
Name: NF0952_low_31
Description: NF0952
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0952_low_31 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 16 - 251
Target Start/End: Original strand, 7102533 - 7102768
Alignment:
| Q |
16 |
atctaacttataaataaagcaaaagccactaaaaacttaggcctctttgctgatagttttgcttctcgttatttattaacagcattgctcttgaaagatt |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102533 |
atctaacttataaataaagcaaaagccactaaaaacttaggcctctttgctgatagttttgcttctcgttatttattaacagcattgctcttgaaagatt |
7102632 |
T |
 |
| Q |
116 |
ggttatattgaataagagaatcacatgatcaacgatagtttggatttactctaagacaaacgtaaaatagacatgttttgatatagttacaaataatttg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102633 |
ggttatattgaataagagaatcacatgatcaacgatagtttggatttactctaagacaaacgtaaaatagacatgttttgatatagttacaaataatttg |
7102732 |
T |
 |
| Q |
216 |
aaataaacttctgcacctcaaatgtgtagttcctat |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
7102733 |
aaataaacttctgcacctcaaatgtgtagttcctat |
7102768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University