View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_48 (Length: 338)
Name: NF0953_high_48
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_high_48 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 20 - 328
Target Start/End: Complemental strand, 35967279 - 35966969
Alignment:
| Q |
20 |
agtttgtgatgtattttgtgtcgctatgttgttttcttgaacttggttgatggatactttttaaatcctttccttacccattttgt--tcgttaaaattt |
117 |
Q |
| |
|
|||||||||||||||||||||| |||| |||||||||||||||||||||||||||| ||||| |||| |||||||||||||||||| | |||||||||| |
|
|
| T |
35967279 |
agtttgtgatgtattttgtgtcactatcttgttttcttgaacttggttgatggatattttttgaatcatttccttacccattttgtgtttgttaaaattt |
35967180 |
T |
 |
| Q |
118 |
atttgtcggcttgattaatatagtccattgtgacttcttcaaaaaataatttttagattaaattttcttcttaatattgtttatccttgtattgtttaga |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35967179 |
atttgtcggcttgattaatatagtccattgtgacttcttcaaaaaataatttttagattaaattttcttcttaatattgtttatccttgtattgtttaga |
35967080 |
T |
 |
| Q |
218 |
gtgtttgcttgttcattgtaattattcatgcttgcgacatatatcttgtgtccatgtctctattttaatgaatttttctttgccttttctacaaaaacta |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35967079 |
gtgtttgcttgttcattgtaattattcatgcttgcgacatatatcttgtgtccatgtctccattttaatgaatttttctttggcttttctacaaaaacta |
35966980 |
T |
 |
| Q |
318 |
gcatagtatta |
328 |
Q |
| |
|
||||||||||| |
|
|
| T |
35966979 |
gcatagtatta |
35966969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University