View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_68 (Length: 252)
Name: NF0953_high_68
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_high_68 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 9222568 - 9222448
Alignment:
Q |
30 |
gattatgattgtgatggtggatttggatggatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaaa |
129 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9222568 |
gattatgattgtgatggtggatttggatggatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaaa |
9222469 |
T |
 |
Q |
130 |
ttaatttgagattaagataac |
150 |
Q |
|
|
||||||||||||||||||||| |
|
|
T |
9222468 |
ttaatttgagattaagataac |
9222448 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 9222392 - 9222346
Alignment:
Q |
206 |
gtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttc |
252 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
9222392 |
gtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttc |
9222346 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University