View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0953_high_68 (Length: 252)

Name: NF0953_high_68
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0953_high_68
NF0953_high_68
[»] chr5 (2 HSPs)
chr5 (30-150)||(9222448-9222568)
chr5 (206-252)||(9222346-9222392)


Alignment Details
Target: chr5 (Bit Score: 121; Significance: 4e-62; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 121; E-Value: 4e-62
Query Start/End: Original strand, 30 - 150
Target Start/End: Complemental strand, 9222568 - 9222448
Alignment:
30 gattatgattgtgatggtggatttggatggatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaaa 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
9222568 gattatgattgtgatggtggatttggatggatagggattataatttataaggagttatgcaattaacgtaatgaatgggttaattaaataaaacagaaaa 9222469  T
130 ttaatttgagattaagataac 150  Q
    |||||||||||||||||||||    
9222468 ttaatttgagattaagataac 9222448  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 206 - 252
Target Start/End: Complemental strand, 9222392 - 9222346
Alignment:
206 gtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttc 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
9222392 gtgattttgcggttgtgcggttaaagggaatattcgaaagcatcttc 9222346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University