View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_77 (Length: 241)
Name: NF0953_high_77
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_high_77 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 15 - 241
Target Start/End: Original strand, 12275895 - 12276117
Alignment:
| Q |
15 |
gacaaaacattgttcatttgtgttctatgtggctctcttaaacccttttcggtcagtaggttccatcaactccggatttttcagatcaagtttcttgttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
12275895 |
gacaaaacattgttcatttgtgttctttgtggctctcttaaacccttttcggt----aggttccatcaactccggattttccagatcaagtttcttgttt |
12275990 |
T |
 |
| Q |
115 |
caaattcgttctcaaatctagtttgtccttcacggaatctcctttcctccttcataactcgcaccaattttgtggtgttgttggtcctagttttctaggg |
214 |
Q |
| |
|
||||| ||||||||||||||||||||||| | ||||||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||||||||| |
|
|
| T |
12275991 |
taaatttgttctcaaatctagtttgtcctttagggaatctccttgcctccttcataactcgcaccaattttgtggtggtgtaggtcctagttttctaggt |
12276090 |
T |
 |
| Q |
215 |
gaccagtatgtgattgttgtttactca |
241 |
Q |
| |
|
||| ||||||||||||||||||||||| |
|
|
| T |
12276091 |
gactagtatgtgattgttgtttactca |
12276117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University