View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_86 (Length: 210)
Name: NF0953_high_86
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_high_86 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 1 - 86
Target Start/End: Original strand, 16956255 - 16956338
Alignment:
Q |
1 |
ttcctgtcctggataatggaattgaaagtgtaatttttctattgcatattacaatttataaacatgatgggaaggaaagaagaaat |
86 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||||| |||||||||||||| |
|
|
T |
16956255 |
ttcctgtcctggataatggaattgaaagtgtaatttttctat--gacattacaatttataaacatgatgggtaggaaagaagaaat |
16956338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 1 - 71
Target Start/End: Complemental strand, 16935048 - 16934978
Alignment:
Q |
1 |
ttcctgtcctggataatggaattgaaagtgtaatttttctattgcatattacaatttataaacatgatggg |
71 |
Q |
|
|
|||| ||||||||||||||||| ||||||| | ||| | || |||||||||||||||||| |||||||| |
|
|
T |
16935048 |
ttccagtcctggataatggaatcgaaagtgcagctttgcaatgtcatattacaatttataaatatgatggg |
16934978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 1 - 99
Target Start/End: Original strand, 26633725 - 26633824
Alignment:
Q |
1 |
ttcctgtcctggataatggaattgaaagtgtaatttttctattgcatattacaatttataaacatgatgggaaggaaagaa-gaaatctgtggttaacat |
99 |
Q |
|
|
|||| ||| |||||||||||||||||||| ||| ||| | || ||||||||||| |||||||||||||| | | || ||| ||||||||||| |||||| |
|
|
T |
26633725 |
ttccagtcttggataatggaattgaaagtctaactttgcaatgtcatattacaatatataaacatgatggtacgtaaggaaggaaatctgtggataacat |
26633824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University