View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_88 (Length: 209)
Name: NF0953_high_88
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_high_88 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 128; Significance: 2e-66; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 128; E-Value: 2e-66
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 33885850 - 33885977
Alignment:
| Q |
1 |
ttcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgtggacaatttctattttacagccactggtgaaaactgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33885850 |
ttcttttcttttttgtgtgactctttaatgcattcttaagtgtagctgattttgaatattgtggacaatttctattttacagccactggtgaaaactgca |
33885949 |
T |
 |
| Q |
101 |
agggagacccttatgagaatgttatatt |
128 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
33885950 |
agggagacccttatgagaatgttatatt |
33885977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University