View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_high_89 (Length: 203)
Name: NF0953_high_89
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_high_89 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 100 - 189
Target Start/End: Complemental strand, 6761638 - 6761549
Alignment:
| Q |
100 |
aaaagttctttatttggaaattttgacttcgagttgcgtacactcagcttattgacttgaaatatgacacttataacttattttgtgata |
189 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6761638 |
aaaagttctttatttggaaagtttgacttcgagttgtgtacactcatcttattgacttgaaatatgacacttataacttattttttgata |
6761549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University