View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_109 (Length: 220)
Name: NF0953_low_109
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_109 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 13 - 98
Target Start/End: Original strand, 42113350 - 42113435
Alignment:
| Q |
13 |
gttcatgaatactgtatcaccaatccttacttcagctttcgacctcaccaccgtaacattaatctcctccttaatagtcctctctg |
98 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
42113350 |
gttcatgaatactttatcaccaatccttacttcagctttcgacctcaccaccgtaacattaatctcttccttaattgtcctctctg |
42113435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University