View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_111 (Length: 216)
Name: NF0953_low_111
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_111 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 1e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 66 - 132
Target Start/End: Complemental strand, 24134368 - 24134302
Alignment:
| Q |
66 |
ttattttattttattcagtacctttaaaaacaatttcaatttttaatatttcactttcatatgtata |
132 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24134368 |
ttattttattttattcagtacccttaaaaacaatttcaatttttaatatttcactttcatatgtata |
24134302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Complemental strand, 24134831 - 24134786
Alignment:
| Q |
1 |
tctataacttggtataatttcaaaattatttatccatggtattttt |
46 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24134831 |
tctataacttggtataatttcaaaattatttacacatggtattttt |
24134786 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 107 - 136
Target Start/End: Complemental strand, 19756558 - 19756529
Alignment:
| Q |
107 |
tttaatatttcactttcatatgtataatat |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
19756558 |
tttaatatttcactttcatatgtataatat |
19756529 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University