View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0953_low_117 (Length: 203)

Name: NF0953_low_117
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0953_low_117
NF0953_low_117
[»] chr6 (1 HSPs)
chr6 (100-189)||(6761549-6761638)


Alignment Details
Target: chr6 (Bit Score: 74; Significance: 4e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 100 - 189
Target Start/End: Complemental strand, 6761638 - 6761549
Alignment:
100 aaaagttctttatttggaaattttgacttcgagttgcgtacactcagcttattgacttgaaatatgacacttataacttattttgtgata 189  Q
    |||||||||||||||||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||| |||||    
6761638 aaaagttctttatttggaaagtttgacttcgagttgtgtacactcatcttattgacttgaaatatgacacttataacttattttttgata 6761549  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University