View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_26 (Length: 460)
Name: NF0953_low_26
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_low_26 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 350; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 350; E-Value: 0
Query Start/End: Original strand, 101 - 450
Target Start/End: Original strand, 32251326 - 32251675
Alignment:
Q |
101 |
cagtaaggcttactttgcaactgcagagagtgtccgtgattcccttatcataaattggaatgcaacatatgaatattatgagagggttaatgttaagcaa |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32251326 |
cagtaaggcttactttgcaactgcagagagtgtccgtgattcccttatcataaattggaatgcaacatatgaatattatgagagggttaatgttaagcaa |
32251425 |
T |
 |
Q |
201 |
gcttattacatgtctatggagtatctacaggttcatattgggtttcctttatgaaacacgggtcattttcattgcaaatgattattaattttcattacta |
300 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32251426 |
gcttattacatgtctatggagtatctacaggttcatattgggtttcctttatgaaacacgggtcattttcattgcaaatgattattaattttcattacta |
32251525 |
T |
 |
Q |
301 |
cattttttcccaattgtgaagggtagggcattgttaaatgcaattgggaatttacaactctcaggtccttatgctgaggctctgaagaagctgggttaca |
400 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32251526 |
cattttttcccaattgtgaagggtagggcattgttaaatgcaattgggaatttacaactctcaggtccttatgctgaggctctgaagaagctgggttaca |
32251625 |
T |
 |
Q |
401 |
atttagaggatgtggctaatcaggttttttcctactattgttctcctttg |
450 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32251626 |
atttagaggatgtggctaatcaggttttttcctactattgttctcctttg |
32251675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University