View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_42 (Length: 401)
Name: NF0953_low_42
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0953_low_42 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 146; Significance: 8e-77; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 146; E-Value: 8e-77
Query Start/End: Original strand, 204 - 356
Target Start/End: Complemental strand, 7234197 - 7234044
Alignment:
Q |
204 |
tgttgatatgcagcaaactttgaacaagaagtgtttattgcacaggaacaattgaatacgaagcatttaaacacaaaagtttaaacaagttaatgtttta |
303 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
7234197 |
tgttgatatgcagcaaactttgaacaagaagtgtttattgcacaggaacaattgaatacgaagcatttaaacacaaaagtttaaacaagttaatgtttta |
7234098 |
T |
 |
Q |
304 |
gtagctcactagtttaaacaagagggtttaaataa-aaaatccatattctgcct |
356 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
T |
7234097 |
gtagctcactagtttaaacaagagggtttaaataaaaaaatccatattctgcct |
7234044 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University