View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_54 (Length: 367)
Name: NF0953_low_54
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 170; Significance: 4e-91; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 170; E-Value: 4e-91
Query Start/End: Original strand, 164 - 349
Target Start/End: Original strand, 30476866 - 30477051
Alignment:
| Q |
164 |
atagcactgatcctatttgagaatcttgatctatattccttgcgctatgatgtgtttctagtttagtgccttacttctgttgccttttttccgttcattg |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476866 |
atagcactgatcctatttgagaatcttgatctatatttcttgtgctacggtgtgtttctagtttagtgccttacttctgttgccttttttccgttcattg |
30476965 |
T |
 |
| Q |
264 |
tttgaagacaatttctatgcatgagactttaggcaaagttctcaaaaaacgatgttaatgacattgtttacttaataccacacaca |
349 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30476966 |
tttgaagacaatttctatgcatgagactttaggcaaagttctcaaaaaacgatgttaatgacattgtttacttaataccacacaca |
30477051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University