View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_61 (Length: 343)
Name: NF0953_low_61
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_61 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 148; Significance: 5e-78; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 148; E-Value: 5e-78
Query Start/End: Original strand, 10 - 185
Target Start/End: Original strand, 12104984 - 12105159
Alignment:
| Q |
10 |
ataatactttgagataatctatataacatctgtagacgaattgacaaatactattcaaaattcacacacaaaagcgagatctaggttttgaactccgctg |
109 |
Q |
| |
|
|||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
12104984 |
ataaaacttcgagataatctatataacatctatagacgaattgacaaatactattcaaaactcacaaataaaagcgagatctaggttttgaactccgctg |
12105083 |
T |
 |
| Q |
110 |
cactagtaacaatatcaactttgtcggttgagttaaactaaaaataaaataaagtaattttaaccctatatattta |
185 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12105084 |
cactggtaacaatatcaactttgtcggttgagttaaactaaaaataaaataaagtaattttaaccctatatattta |
12105159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 6e-22
Query Start/End: Original strand, 198 - 251
Target Start/End: Original strand, 12105597 - 12105650
Alignment:
| Q |
198 |
tctcattattcaacatctcactctcatctttcatgatctcctcaatcacactcc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12105597 |
tctcattattcaacatctcactctcatctttcatgatctcctcaatcacactcc |
12105650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University