View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_65 (Length: 336)
Name: NF0953_low_65
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_65 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 99 - 327
Target Start/End: Complemental strand, 6085572 - 6085343
Alignment:
| Q |
99 |
catttcacttgttaaactgatacacttgttttcgtttcggctttgttcttgtccctagcatccttttccacaagcttaatcgtccatatttcttggcagg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085572 |
catttcacttgttaaactgatacacttgttttcgtttcggctttgttcttgtccctagcatccttttccacaagcttaatcgtccatatttcttggcagg |
6085473 |
T |
|
| Q |
199 |
taaa-tggccaaagaattgacattaacatcgtcatcacggccttttaatcctttcaaaactacgatcttttcaagtggctgtataaaatttctttcgctt |
297 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6085472 |
taaaatggccaaagaattgacattaacatcgtcatcacggccttttaatcctttcaaaactacgatcttttcaagtggctgtataaaatttctttcgctt |
6085373 |
T |
|
| Q |
298 |
gttttacaaaacttggcttttgcttcatct |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
6085372 |
gttttacaaaacttggcttttgcttcatct |
6085343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University