View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0953_low_68 (Length: 325)
Name: NF0953_low_68
Description: NF0953
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0953_low_68 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 13 - 229
Target Start/End: Complemental strand, 34078781 - 34078565
Alignment:
| Q |
13 |
aatattagtctcaaaaatcattcgagataggcatataggaaaatctccatctttgcataagaaaaataaccttcctcctggcccaccaaggtggcctatt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078781 |
aatattagtctcaaaaatcattcgagataggcatataggaaaatctccatctttggataagaaaaataaccttcctcctggcccaccaaggtggcctatt |
34078682 |
T |
 |
| Q |
113 |
gttggtaaccttctccaattagggcaacttcctcatagagacttagcatcattatgtgataaatatggacccttagtttatttaaaattaggaaatattg |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34078681 |
gttggtaaccttctccaattagggcaacttcctcatagagacttagcatcattatgcgataaatatggacccttagtttatttaaaattaggaaatattg |
34078582 |
T |
 |
| Q |
213 |
atgctattactactaat |
229 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
34078581 |
atgctattactactaat |
34078565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University